February 27, 2004
Administrator, please hope me! What do you do when you can't remember your MoFi password? Passwords are a thing of the past, anyway. How about giving us your fingerprint? Or a retina scan? Maybe we could have a MonkeyCard that plugs straight into the computer. In any case, I'll be asking for samples of your DNA before you can log in again.
The thing about fingerprints and eyescans and the like is that essentially they are still just passwords, just more complex. The trouble is, that unlike a normal password, if these get compromised or cracked, you can't change them. Ever. So you'll be stuck with a worse than useless password for the rest of your life.
Inkblots! That’s what we need. Microsoft research suggests may be the answer to remembering passwords. Scroll down the page and try the inkblot test for yourself. Watch out for that flying green gorilla though.
You want a DNA sample? *smirks* It's like dng said though, and it isn't just for life. You don't need a whole body for a fingerprint scanner after all. I've always been a fan of the purloined letter trick myself, plain sight and none the wiser.
I saw:
1. Vaulting man in Shorts with Weasels on Arse
2. Sumo Gorilla
3. Crab Porn
4. Star Wars Pod Race
5. Ducks, possibly in a Beckett Play
6. Bra, with Gloves and Grey Skin
7. A small Dinosaur which Cannot Fly, but is Trying Very Hard
8. Two Ants on Crack
9. Jolly Green Mincing Giant
10. Glam Rock Star, occluded by Demon
I’m not sure that’ll help me remember that my password is VESGCPSEDYBNADTKJTGN.
Other thing about DNA-as-password is that, not only can you not change them, you end up with the same password for every single thing. Which is less secure, and is definitely not something that any of us would be foolish enough to do with the current system.
*hurries off to change myriad identical passwords to VESGCPSEDYBNADTKJTGN*
cracking my fingerprint is one thing. but what happens if i have my system fingerprint-protected, and then i go and lose my fingers in an accident? do i wake up on the operating table and say "don't toss those digits, doc, i need 'em to unlock my copy of windows!"???
and let's not even go into all the trouble this would cause if that hand-transplant thing ever works out like they thought it would...
Tracicle - already sorted.
My password is ATCGATACCATAGTCATAGTA
CTGGTTGGGCIAMAWANKERATCGGGATACACATTCTA...
Well, you get the idea.
1. baby wedged in a goatse
2. elephantiasis victim
3. even poppy petals have crowquills
4. your feet's too big
5. green berets and yellow snow
6. seriously abducted thighs
7. greenwinged penguin looms
8. dove's ghost between fungoid bookends
9. caped hero by Edward Gorey
10. Batman wants a purple tutu
Okay, trac, I'm emailing you a sample of my blood (since I just accidentally stapled my thumb while standing over my scanner, I thought something good should come of it).
Wendell: watch out, that's almost how Jack Black's Computerman was formed.
That's an interesting article, homunculus. (although it really does take ages to get through the adverts for the day pass, doesn't it?)
But it still never really mentions the main worry about using biometric data as passwords: they cannot be changed (as I - and others - have already said). This is much more important than the civil liberties angle, really (not to dismiss that, obviously) - passwords which cannot be changed are worse than useless. No matter how complex they are, all passwords eventually come down to be a series of zeroes and ones, and all passwords have to be stored somewhere. Oh boy, a hacker's dream...
« Older The 'Bashi Thread | Apes on Bikes! Newer »
To post comments to a thread you must login or create a profile.
